Products
We invite you to be our distributor in your region. Contact: tel. +7 383 363-51-91, 363 22 40, e-mail: mail@biosan-nsk.ru, sales@biolabmix.ru
ЗАО «Биосан» является исполнителем НИОКР при поддержке Фонда содействия инновациям.

Т7 RNA PolymeraseOrder

Features: Isolated from a recombinant source.
T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter.
Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
Cat.№NameAmountPrice, €Order
E-1100Т7 RNA Polymerase1 000 000 unitsOrder